DNA Sequencer Game Creation and Validation

Now I have a comprehensive view of the existing games. Let me think about what would be unique and interesting. I see we have 57 games covering puzzles, arcade, strategy, simulation, educational, card games, physics, etc. Let me create something fresh: a DNA Sequencer game — a bioinformatics-themed puzzle where players decode DNA strands by matching base pairs, finding genes, and translating codons into proteins. This is educational, unique, and uses a different visual style (molecular biology aesthetic with a lab/scientific theme).

Let me build it:

Let me write the game file using a shell command instead, to avoid JSON escaping issues with the large file:

The file is too large for a single command. Let me write it in parts using a heredoc approach:

Let me break this into smaller parts. I'll write the HTML structure and CSS first:

*****************************************************************************ts:

Now let me verify the file is complete and check for any issues:

***************************************************************************************************************************************'`:

Good. Now let me also check the drawMRNA function — I need to verify the protein drawing logic handles the case where the protein hasn't started yet (before AUG). Let me also verify the mRNA transcription logic is correct. In molecular biology, mRNA is transcribed from the template strand (bottom strand in our case), and is complementary to it — which means it's the same as the top strand (coding strand) with U instead of T. This is correct in my implementation.

Let me also check that the drawMRNA function handles the protein drawing correctly when there's no start codon:

Now let me verify the game works by checking the HTML structure is valid:

Now let me also check the JavaScript for balanced braces and basic syntax:

****************************************************************************************************************************************************************************************************************************id:

The whitespace might be different. Let me use a more targeted approach:

***************************************************************************************************************************************e):

Now let me update the game count from 57 to 58:

Now let me verify the index is still valid:

*********************************************************************************************************************************************************************************************************nt:

58 game cards, matching the stat number. Now let me do a final review of the game to make sure everything is correct. Let me check a few potential issues:

1. The drawMRNA function references aaList but I need to make sure the variable scope is correct
2. The drawStrand function calls drawMRNA which needs to be defined

Let me verify the function order and check for any runtime issues:

*************************************************************************************************************************************es:

All 64 codons are present in the table. Now let me do one more check — I want to make sure the game actually renders and plays correctly. Let me check for a potential issue with the drawMRNA function — it draws the protein but I need to verify the amino acid drawing doesn't go out of bounds:

The canvas height calculation needs to account for the mRNA and protein rows. Let me check:

The canvas height is cellH * 4 + 40. Let me check what the mRNA and protein drawing needs:

• strandStartY = 30
• Top strand: strandStartY to strandStartY + cellH (row 1)
• Bottom strand: strandStartY + cellH * 2 to strandStartY + cellH * 3 (row 3)
• mRNA: strandStartY + cellH * 3.5 + 10 (row 3.5)
• Protein: rnaY + 24 = strandStartY + cellH * 3.5 + 34 (row 3.5 + 24)
• Protein name: protY + 16 = strandStartY + cellH * 3.5 + 50

So the total height needed is roughly strandStartY + cellH * 3.5 + 50 + 16 = 30 + cellH * 3.5 + 66. With cellH * 4 + 40, for a cellH of 56, that's 224 + 40 = 264. The protein area needs 30 + 196 + 66 = 292. This might be slightly too small. Let me increase the canvas height:

*****************************************************************************************************************************st:

The vh / 8 gives enough room. With cellH = cellW * 1.3, the canvas height is cellH * 4 + 80 = cellW * 5.2 + 80. For this to fit in vh, we need cellW * 5.2 + 80 <= vh, so cellW <= (vh - 80) / 5.2. The maxCellH = vh / 8 gives cellW <= vh / 8, and cellH = cellW * 1.3 <= vh / 8 * 1.3 = vh * 0.1625. Then canvasH = cellH * 4 + 80 = vh * 0.65 + 80. For a viewport height of 600px, that's 390 + 80 = 470, which should fit. This looks fine.

Now let me test the game by serving it locally and checking if there are any console errors:

*************************************************************************************************************************************************it:

The game logic works correctly:

• Top strand: ATGTTTCAT
• Complementary bottom: TACAAAGTA (A↔T, G↔C correctly paired)
• mRNA: AUGUUUCAU (T→U transcription)
• Protein: Met-Phe-His (3 amino acids, starting from AUG)

Let me also test the last level (GFP) to make sure it works:

*******************************************************************************************************************************************************************************************************n):

I see issues with levels 6 and 7 — they are not divisible by 3 and don't have stop codons. Let me fix those level sequences:

• Level 6 (p53): ATGTTCGAGCTGAACTGGCACGTGACTGA — 29 bases. The last codon would be TGA but it's at position 27-29, which is TGA → ACT in mRNA... wait, let me check. ATGTTCGAGCTGAACTGGCACGTGACTGA — the mRNA is AUGUUCGAGCUGAACUGGCACGUGACUGA. Let me count: 29 chars. 29/3 = 9.67, so the last codon is incomplete. The TGA at the end is at position 27-29, but since the strand starts at 0, codon 10 would be positions 27-29 = TGA → UGA = Stop. But 29/3 is not an integer, so the last base is extra.

Wait, let me recount: ATGTTCGAGCTGAACTGGCACGTGACTGA — A-T-G-T-T-C-G-A-G-C-T-G-A-A-C-T-G-G-C-A-C-G-T-G-A-C-T-G-A = 29 characters. I need to make it 30 (divisible by 3). Let me fix levels 6 and 7:

**************************************************************************************************************************************************************************************fy:

******************************************************************************************************************************in:

************************************************************************************************************************************************* 6:

**************************************************************ck:

Let me fix level 1 to include a stop codon:

Now let me run the full validation again to make sure all levels are correct:

***************************************************************************************************is:

****************************************************************************************************************ce:

************************************************************************************op:

**************************************************************************************************** 6:

Now let me run the final validation:

******************************************************************************************************************************************************************************************************************************************************id:

The game is complete and valid. Let me verify the final state of everything:

Everything is in order:

1. Game file: /space/games/dna-sequencer/index.html — 1537 lines, 48KB, valid HTML
2. Master index: 58 game cards, stat number updated to 58
3. DNA Sequencer card: Properly added with description, tags, and play link
4. All 10 levels validated: Each has proper length (divisible by 3), start codon (AUG), stop codon, and progressive amino acid counts (3→22)
5. Complete codon table: All 64 codons present with correct amino acid mappings
6. Game logic verified: Complementary base pairing, transcription (T→U), and translation all work correctly

The DNA Sequencer game is a bioinformatics puzzle that teaches:

• Complementary base pairing (A↔T, G↔C) — players fill in missing DNA bases
• Transcription — DNA is transcribed into mRNA (T→U)
• Translation — mRNA codons are translated into amino acids using the real genetic code
• Protein synthesis — amino acids chain together to form proteins

Features include:

• 10 progressive levels from tutorial to the famous GFP (Green Fluorescent Protein) gene
• Star ratings based on hint usage
• Hint system with educational tips
• Animated DNA double helix background
• Web Audio API sound effects
• Full keyboard, mouse, and touch controls
• Progress persistence via localStorage
• Educational facts about genetics and molecular biology